Genos-10B-v2

This repository hosts the model weights for Genos-10B-v2. For instructions and details, please refer to the Genos GitHub.

The Genos collection of models are foundation models for the human genome, achieving million-base-pair context modeling and single-nucleotide resolution learning capability for the human genome sequence. Genos adheres to the open science principles of collaboration, sharing, and co-construction, with a strong commitment to supporting the global genomics research community. To this end, we have openly released three models:

• Genos-1.2B: a 1.2 billion parameter model designed for high-efficiency genome sequence analysis.
• Genos-10B: a larger model with 10 billion parameters, offering enhanced performance for complex genomic tasks.
• Genos-10B-v2: an enhanced version trained with additional human and non-human genomes to expand evolutionary context and sequence diversity.

We also provide checkpoints trained under the Megatron-LM framework:

• Genos-Megatron-1.2B
• Genos-Megatron-10B
• Genos-Megatron-10B-v2

Test Command

curl --max-time 60 -sS http://127.0.0.1:6000/v1/completions -H 'Content-Type: application/json' --data-binary @- <<'EOF'
{"model":"BGI-HangzhouAI/Genos-10B-v2","prompt":"ACGTACGTACGTACGTACGT","temperature":0.2,"max_tokens":32,"stream":false,"skip_special_tokens":false}
EOF

Supported GPUs:

• Generic